algorithms imaris v10 2 1 oxford instruments (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imaris v10 2 1 oxford instruments
Algorithms Imaris V10 2 1 Oxford Instruments, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44064 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imaris/Imaris/pm42214342-268-94-95
Average 99 stars, based on 44064 article reviews
Algorithms Imaris V10 2 1 Oxford Instruments, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44064 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imaris/Imaris/pm42214342-268-94-95
Average 99 stars, based on 44064 article reviews
algorithms imaris v10 2 1 oxford instruments - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Recombinant:Article Title: Chemical and mechanical patterning of tortoise skin scales occur in different regions of the head Article Snippet: Samples were then washed in blocking solution prior to overnight labelling with anti-DIG (Sigma-Aldrich). .. Next, samples were REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Tortoise embryos Tropiquarium de Servion’ (Servion, Switzerland) N/A Erlebnis-Bauernhof Wannenwis (Waldkirch, Switzerland) N/A Breeding colony of the Milinkovitch-Tzika laboratory (University of Geneva, Switzerland) N/A Chemicals, peptides, and recombinant proteins Tween 20 SigmaAldrich P1379 Triton X-100 SigmaAldrich 93443 Proteinase K SigmaAldrich P6556 DIG RNA labeling kit Roche 11175025910 Anti-Digoxigenin-AP, Fab fragments Roche 11093274910 TO-PRO-3 Iodide ThermoFisher T3605 YO-PRO-1 Iodide ThermoFisher Y3603 Alizarin Red ThermoFisher 400481000 Baseclick EdU Assay Baseclick BCK-EdU555IM100 Dichloromethane (DCM) SigmaAldrich 270997 Dibenzyl ether (DBE) SigmaAldrich 33630 Software and Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Article Title: In vivo differentiation of embryonic cells devoid of key reprogramming factors. Article Snippet: 55,56 The maintenance of fish lines was carried out in accordance with the AAALAC research guidelines following a protocol approved by the Yale University IACUC. .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCS2+dsRed This paper N/A pCS2+EGFP-CAAX This paper N/A pCS2+nanog Lee et al. 3 N/A pCS2+pou5f3 Lee et al. 3 N/A pCS2-hCD4 This paper N/A Software and Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-Vasa Santa Cruz Biotechnology Cat# sc-26877 (dC-13), RRID:AB_793880 Discontinued Mouse monoclonal anti Fasciclin III Developmental Studies Hybridoma Bank DSHB: 7G10; RRID:AB_528238 Rabbit polyclonal anti STAT92E E. Bach N/A Rabbit polyclonal anti RFP Abcam ab62341; RRID:AB_945213 Mouse monoclonal anti Gamma Tubulin Sigma GTU-88, T6557, RRID:AB_477584 Chick polyclonal anti GFP Aves Labs Cat#GFP-1020; RRID: AB_2307313 Rat monoclonal anti DE-Cadherin Developmental Studies Hybridoma Bank DSHB: DCAD2; RRID: AB_528120 Normal Donkey Serum (NDS) Jackson ImmunoResearch Cat#: 017-000-121; RRID: AB_2337258 Alexafluor Secondary Antibodies (488, 647) Jackson ImmunoResearch RRID: AB_2307351; RRID: AB_2340863; RRID: AB_2340375; RRID: AB_2313584; RRID: AB_2341099; RRID: AB_2340667 Cy3 Affinipure Secondary Antibodies Jackson ImmunoResearch Cat#: 711-165-152; RRID: AB_2307443 Chemicals, peptides, and recombinant proteins Para-Formaldehyde (PFA), 16% Electron Microscopy Sciences Cat#15710 Hoechst Sigma Cat#33342; CAS Number: 875756-97-1 Propyl-gallate Sigma Aldrich SKU: P3130; CAS Number 121-79-9; PubChem Substance ID 24898394 Normal Donkey Serum (NDS) Jackson Immunoresearch Laboratories 017-000-121; RRID: AB_2337258 Ringer’s solution Other doi: https://doi.org/10.1101/pdb.rec12409 Schneider’s Insect Media GIBCO 21720-024 Insulin, bovine Sigma Cat# 10516 Penicillin/ Streptomycin Corning 30-002-Cl Fetal Bovine Serum GIBCO Cat# 10082 Critical commercial assays Gateway LR Clonase II Enzyme mix ThermoFisher Scientific Cat#: 11791020 SpinSmart Plasmid Purification: Low-copy plasmid DNA, P1 constructs, or cosmids Denville Scientific Cat#CM-410-50 Experimental models: Cell lines DH5 alpha Cells NEB Cat#C2987H oneShot Top10 Invitrogen Cat#C404006 Experimental models: Organisms/strains P-Dsix4-eGFP::Moesin Sano et al.59 N/A nos-moesin::GFP Sano et al.60 Flybase: FBtp0040584 UAS-Stat92E RNAi Bloomington Drosophila Stock Center Flybase: FBst0033637; RRID: BDSC_33637 sqh-Sqh::mCherry Rauzi et al.32 N/A sqh-Sqh::GFP3x Pinheiro et al.61 N/A UAS-GFP::Zipper Franke et al.34 N/A UAS-F-Tractin::tdTomato Bloomington Drosophila Stock Center RRID: BDSC_58989 Six4-Gal4 Anllo et al.12 N/A Six4-Gal4::VP16 S. DiNardo This Work nos-Gal4-VP16 Van Doren et al.62 N/A P{CaryP}attP2 Bloomington Drosophia Stock Center Flybase: FBti0040535; RRID: BDSC_8622 (Continued on next page) Current Biology 34, 3917–3930.e1–e6, September 9, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and Labeling:Article Title: Chemical and mechanical patterning of tortoise skin scales occur in different regions of the head Article Snippet: Samples were then washed in blocking solution prior to overnight labelling with anti-DIG (Sigma-Aldrich). .. Next, samples were REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Tortoise embryos Tropiquarium de Servion’ (Servion, Switzerland) N/A Erlebnis-Bauernhof Wannenwis (Waldkirch, Switzerland) N/A Breeding colony of the Milinkovitch-Tzika laboratory (University of Geneva, Switzerland) N/A Chemicals, peptides, and recombinant proteins Tween 20 SigmaAldrich P1379 Triton X-100 SigmaAldrich 93443 Proteinase K SigmaAldrich P6556 DIG RNA labeling kit Roche 11175025910 Anti-Digoxigenin-AP, Fab fragments Roche 11093274910 TO-PRO-3 Iodide ThermoFisher T3605 YO-PRO-1 Iodide ThermoFisher Y3603 Alizarin Red ThermoFisher 400481000 Baseclick EdU Assay Baseclick BCK-EdU555IM100 Dichloromethane (DCM) SigmaAldrich 270997 Dibenzyl ether (DBE) SigmaAldrich 33630 Software and EdU Assay:Article Title: Chemical and mechanical patterning of tortoise skin scales occur in different regions of the head Article Snippet: Samples were then washed in blocking solution prior to overnight labelling with anti-DIG (Sigma-Aldrich). .. Next, samples were REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Tortoise embryos Tropiquarium de Servion’ (Servion, Switzerland) N/A Erlebnis-Bauernhof Wannenwis (Waldkirch, Switzerland) N/A Breeding colony of the Milinkovitch-Tzika laboratory (University of Geneva, Switzerland) N/A Chemicals, peptides, and recombinant proteins Tween 20 SigmaAldrich P1379 Triton X-100 SigmaAldrich 93443 Proteinase K SigmaAldrich P6556 DIG RNA labeling kit Roche 11175025910 Anti-Digoxigenin-AP, Fab fragments Roche 11093274910 TO-PRO-3 Iodide ThermoFisher T3605 YO-PRO-1 Iodide ThermoFisher Y3603 Alizarin Red ThermoFisher 400481000 Baseclick EdU Assay Baseclick BCK-EdU555IM100 Dichloromethane (DCM) SigmaAldrich 270997 Dibenzyl ether (DBE) SigmaAldrich 33630 Software and Software:Article Title: Chemical and mechanical patterning of tortoise skin scales occur in different regions of the head Article Snippet: Samples were then washed in blocking solution prior to overnight labelling with anti-DIG (Sigma-Aldrich). .. Next, samples were REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Tortoise embryos Tropiquarium de Servion’ (Servion, Switzerland) N/A Erlebnis-Bauernhof Wannenwis (Waldkirch, Switzerland) N/A Breeding colony of the Milinkovitch-Tzika laboratory (University of Geneva, Switzerland) N/A Chemicals, peptides, and recombinant proteins Tween 20 SigmaAldrich P1379 Triton X-100 SigmaAldrich 93443 Proteinase K SigmaAldrich P6556 DIG RNA labeling kit Roche 11175025910 Anti-Digoxigenin-AP, Fab fragments Roche 11093274910 TO-PRO-3 Iodide ThermoFisher T3605 YO-PRO-1 Iodide ThermoFisher Y3603 Alizarin Red ThermoFisher 400481000 Baseclick EdU Assay Baseclick BCK-EdU555IM100 Dichloromethane (DCM) SigmaAldrich 270997 Dibenzyl ether (DBE) SigmaAldrich 33630 Software and Article Title: Patient-derived tumor organoid and fibroblast assembloid models for interrogation of the tumor microenvironment in esophageal adenocarcinoma Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-Pan-Cytokeratin (Clone AE1/AE3) Agilent Cat#M351529-2; RRID:AB_2132885 Rabbit Anti-Vimentin Cell Signaling Technology Cat#5741S; RRID:AB_10695459 Rabbit Anti-Cytokeratin 7 (Clone EPR1619Y) Abcam Cat#Ab68459; RRID:AB_1139824 Mouse Anti-Cytokeratin 20 (Clone Ks20.8) Invitrogen Cat#MA5-13263; RRID:AB_10981940 Rabbit Anti-Ki-67 Abcam Cat#Ab15580; RRID:AB_443209 Mouse Anti-alpha Smooth Muscle Actin (clone 1A4) Agilent Cat#M085101-2; RRID:AB_2223500 Rabbit Anti-Periostin Abcam Cat#Ab14041;RRID:AB_2299859 Alexa Fluor 488 Goat Anti-Mouse IgG Invitrogen Cat#A-11029; RRID:AB_2534088 Alexa Fluor 633 Goat Anti-Mouse IgG Invitrogen Cat#A-21052; RRID:AB_2535719 Alexa Fluor 488 Goat Anti-Rabbit IgG Invitrogen Cat#A-11008; RRID:AB_143165 Alexa Fluor 568 Goat Anti-Rabbit IgG Invitrogen Cat#A-11036; RRID:AB_10563566 Biological samples Human esophageal adenocarcinoma FFPE blocks University Hospital Southampton, Department of Cellular Pathology See Table 1 Chemicals, peptides, and recombinant proteins DAPI Sigma-Aldrich Cat#D9542-5MG Hanks’ Balanced Salt Solution ThermoFisher Cat#14025092 Amphotericin B ThermoFisher Cat#15290026 Collagenase P Sigma-Aldrich Cat#11213865001 Primocin InvivoGen Cat#ant-pm-05 Penicillin-Streptomycin ThermoFisher Cat#15140122 Cultrex Basement Membrane Extract, Type 2, Pathclear Bio-Techne Cat#3532-005-02 Advanced DMEM/F12 ThermoFisher Cat#12634010 HEPES ThermoFisher Cat#15630056 GlutaMAX ThermoFisher Cat#35050061 N-2 Supplement ThermoFisher Cat#17502048 B-27 Supplement ThermoFisher Cat#17504044 Recombinant Human Noggin Peprotech Cat#120-10C-500 Recombinant Human EGF Peprotech Cat#AF-100-15-1000 Recombinant Human FGF-10 Peprotech Cat#100-26-1000 N-Acetylcysteine Sigma-Aldrich Cat#A9165-5g Nicotinamide Sigma-Aldrich Cat#N0636-100g A83-01 TOCRIS Cat#2939-10mg SB202190 Stem Cell Technologies Cat#72634 Y-27632 Sigma-Aldrich Cat#Y0503-5MG TrypLE Express ThermoFisher Cat#12604013 Fructose Sigma-Aldrich Cat#F3510-100G Glycerol Sigma-Aldrich Cat#G5516-500ML Urea Sigma-Aldrich Cat#51456-500G Zwittergent 3-10 Sigma-Aldrich Cat#693021-5GM Boric Acid Sigma-Aldrich Cat#B6768 Phalloidin-iFluor594 Abcam Cat#176757 Triton X-100 Sigma-Aldrich Cat#T8787-50ML (Continued on next page) e1 Cell Reports Methods 4, 100909, December 16, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Sigma-Aldrich Cat#A2153-10G Agarose Sigma-Aldrich Cat#A9539-100G 4% Paraformaldehyde ThermoFisher Cat#I28800 Xylene, Reagent Grade Sigma-Aldrich Cat#214736 Eosin Y solution, Alcoholic Sigma-Aldrich Cat#HT110116 Mayer’s Hematoxylin Agilent Cat#S330930-2 Expert XTF Mounting Medium CellPath Cat#SEA-1900-00A Alcian blue Sigma-Aldrich Cat#A3157-10G Schiff’s Reagent Sigma-Aldrich Cat#3952016-500ML Sirius Red F3B Sigma-Aldrich Cat#365548-5G Saturated Aqueous Picric Acid Sigma-Aldrich Cat#P6744-1GA Mowiol 4-88 Sigma-Aldrich Cat#81381-50G DABCO 33-LV Sigma-Aldrich Cat#290734-100ML Dulbecco’s Modified Eagle’s Medium, High Glucose Sigma-Aldrich Cat#D6546 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74104 Deposited data Bulk RNA-seq data This paper GSE277147 Microscopy data This paper https://doi.org/10.5281/ zenodo.11639336 Experimental models: Cell lines OESO-005 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0290-C15 OESO-191 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0543-C15 OESO-195 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0546-C15 CAF1412 This paper See Table 1 CAF669 This paper See Table 1 L-Wnt3A ATCC Cat#CRL-2647; RRID:CVCL_0635 HA-R-Spondin1-FC 293T R&D Systems Cat#3710-001-01; RRID:CVCL_RU08 Software and Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Article Title: In vivo differentiation of embryonic cells devoid of key reprogramming factors. Article Snippet: 55,56 The maintenance of fish lines was carried out in accordance with the AAALAC research guidelines following a protocol approved by the Yale University IACUC. .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCS2+dsRed This paper N/A pCS2+EGFP-CAAX This paper N/A pCS2+nanog Lee et al. 3 N/A pCS2+pou5f3 Lee et al. 3 N/A pCS2-hCD4 This paper N/A Software and Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-Vasa Santa Cruz Biotechnology Cat# sc-26877 (dC-13), RRID:AB_793880 Discontinued Mouse monoclonal anti Fasciclin III Developmental Studies Hybridoma Bank DSHB: 7G10; RRID:AB_528238 Rabbit polyclonal anti STAT92E E. Bach N/A Rabbit polyclonal anti RFP Abcam ab62341; RRID:AB_945213 Mouse monoclonal anti Gamma Tubulin Sigma GTU-88, T6557, RRID:AB_477584 Chick polyclonal anti GFP Aves Labs Cat#GFP-1020; RRID: AB_2307313 Rat monoclonal anti DE-Cadherin Developmental Studies Hybridoma Bank DSHB: DCAD2; RRID: AB_528120 Normal Donkey Serum (NDS) Jackson ImmunoResearch Cat#: 017-000-121; RRID: AB_2337258 Alexafluor Secondary Antibodies (488, 647) Jackson ImmunoResearch RRID: AB_2307351; RRID: AB_2340863; RRID: AB_2340375; RRID: AB_2313584; RRID: AB_2341099; RRID: AB_2340667 Cy3 Affinipure Secondary Antibodies Jackson ImmunoResearch Cat#: 711-165-152; RRID: AB_2307443 Chemicals, peptides, and recombinant proteins Para-Formaldehyde (PFA), 16% Electron Microscopy Sciences Cat#15710 Hoechst Sigma Cat#33342; CAS Number: 875756-97-1 Propyl-gallate Sigma Aldrich SKU: P3130; CAS Number 121-79-9; PubChem Substance ID 24898394 Normal Donkey Serum (NDS) Jackson Immunoresearch Laboratories 017-000-121; RRID: AB_2337258 Ringer’s solution Other doi: https://doi.org/10.1101/pdb.rec12409 Schneider’s Insect Media GIBCO 21720-024 Insulin, bovine Sigma Cat# 10516 Penicillin/ Streptomycin Corning 30-002-Cl Fetal Bovine Serum GIBCO Cat# 10082 Critical commercial assays Gateway LR Clonase II Enzyme mix ThermoFisher Scientific Cat#: 11791020 SpinSmart Plasmid Purification: Low-copy plasmid DNA, P1 constructs, or cosmids Denville Scientific Cat#CM-410-50 Experimental models: Cell lines DH5 alpha Cells NEB Cat#C2987H oneShot Top10 Invitrogen Cat#C404006 Experimental models: Organisms/strains P-Dsix4-eGFP::Moesin Sano et al.59 N/A nos-moesin::GFP Sano et al.60 Flybase: FBtp0040584 UAS-Stat92E RNAi Bloomington Drosophila Stock Center Flybase: FBst0033637; RRID: BDSC_33637 sqh-Sqh::mCherry Rauzi et al.32 N/A sqh-Sqh::GFP3x Pinheiro et al.61 N/A UAS-GFP::Zipper Franke et al.34 N/A UAS-F-Tractin::tdTomato Bloomington Drosophila Stock Center RRID: BDSC_58989 Six4-Gal4 Anllo et al.12 N/A Six4-Gal4::VP16 S. DiNardo This Work nos-Gal4-VP16 Van Doren et al.62 N/A P{CaryP}attP2 Bloomington Drosophia Stock Center Flybase: FBti0040535; RRID: BDSC_8622 (Continued on next page) Current Biology 34, 3917–3930.e1–e6, September 9, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and Article Title: Manipulating condensation of thermo-sensitive SUF4 protein tunes flowering time in Arabidopsis thaliana. Article Snippet: Additionally, the mEGFP gene was amplified from addgene’s commercially available mEGFP plasmid (#18696) using oHM1, a primer with a BglII 5′ site, and oHM2, a primer with a 3′ BamHI site. .. REAGENT or RESOURCE SOURCE IDENTIFIER pELF7:mTFP-ELF7 This paper pFastBac-mVenus This paper pFastBac-mVenus-SUF4 This paper pFastBac-mVenus-5SSUF4 This paper pFastBac-mVenus-12SUF4 This paper Software and Saline:Article Title: Chemical and mechanical patterning of tortoise skin scales occur in different regions of the head Article Snippet: Samples were then washed in blocking solution prior to overnight labelling with anti-DIG (Sigma-Aldrich). .. Next, samples were REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Tortoise embryos Tropiquarium de Servion’ (Servion, Switzerland) N/A Erlebnis-Bauernhof Wannenwis (Waldkirch, Switzerland) N/A Breeding colony of the Milinkovitch-Tzika laboratory (University of Geneva, Switzerland) N/A Chemicals, peptides, and recombinant proteins Tween 20 SigmaAldrich P1379 Triton X-100 SigmaAldrich 93443 Proteinase K SigmaAldrich P6556 DIG RNA labeling kit Roche 11175025910 Anti-Digoxigenin-AP, Fab fragments Roche 11093274910 TO-PRO-3 Iodide ThermoFisher T3605 YO-PRO-1 Iodide ThermoFisher Y3603 Alizarin Red ThermoFisher 400481000 Baseclick EdU Assay Baseclick BCK-EdU555IM100 Dichloromethane (DCM) SigmaAldrich 270997 Dibenzyl ether (DBE) SigmaAldrich 33630 Software and Modification:Article Title: Patient-derived tumor organoid and fibroblast assembloid models for interrogation of the tumor microenvironment in esophageal adenocarcinoma Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-Pan-Cytokeratin (Clone AE1/AE3) Agilent Cat#M351529-2; RRID:AB_2132885 Rabbit Anti-Vimentin Cell Signaling Technology Cat#5741S; RRID:AB_10695459 Rabbit Anti-Cytokeratin 7 (Clone EPR1619Y) Abcam Cat#Ab68459; RRID:AB_1139824 Mouse Anti-Cytokeratin 20 (Clone Ks20.8) Invitrogen Cat#MA5-13263; RRID:AB_10981940 Rabbit Anti-Ki-67 Abcam Cat#Ab15580; RRID:AB_443209 Mouse Anti-alpha Smooth Muscle Actin (clone 1A4) Agilent Cat#M085101-2; RRID:AB_2223500 Rabbit Anti-Periostin Abcam Cat#Ab14041;RRID:AB_2299859 Alexa Fluor 488 Goat Anti-Mouse IgG Invitrogen Cat#A-11029; RRID:AB_2534088 Alexa Fluor 633 Goat Anti-Mouse IgG Invitrogen Cat#A-21052; RRID:AB_2535719 Alexa Fluor 488 Goat Anti-Rabbit IgG Invitrogen Cat#A-11008; RRID:AB_143165 Alexa Fluor 568 Goat Anti-Rabbit IgG Invitrogen Cat#A-11036; RRID:AB_10563566 Biological samples Human esophageal adenocarcinoma FFPE blocks University Hospital Southampton, Department of Cellular Pathology See Table 1 Chemicals, peptides, and recombinant proteins DAPI Sigma-Aldrich Cat#D9542-5MG Hanks’ Balanced Salt Solution ThermoFisher Cat#14025092 Amphotericin B ThermoFisher Cat#15290026 Collagenase P Sigma-Aldrich Cat#11213865001 Primocin InvivoGen Cat#ant-pm-05 Penicillin-Streptomycin ThermoFisher Cat#15140122 Cultrex Basement Membrane Extract, Type 2, Pathclear Bio-Techne Cat#3532-005-02 Advanced DMEM/F12 ThermoFisher Cat#12634010 HEPES ThermoFisher Cat#15630056 GlutaMAX ThermoFisher Cat#35050061 N-2 Supplement ThermoFisher Cat#17502048 B-27 Supplement ThermoFisher Cat#17504044 Recombinant Human Noggin Peprotech Cat#120-10C-500 Recombinant Human EGF Peprotech Cat#AF-100-15-1000 Recombinant Human FGF-10 Peprotech Cat#100-26-1000 N-Acetylcysteine Sigma-Aldrich Cat#A9165-5g Nicotinamide Sigma-Aldrich Cat#N0636-100g A83-01 TOCRIS Cat#2939-10mg SB202190 Stem Cell Technologies Cat#72634 Y-27632 Sigma-Aldrich Cat#Y0503-5MG TrypLE Express ThermoFisher Cat#12604013 Fructose Sigma-Aldrich Cat#F3510-100G Glycerol Sigma-Aldrich Cat#G5516-500ML Urea Sigma-Aldrich Cat#51456-500G Zwittergent 3-10 Sigma-Aldrich Cat#693021-5GM Boric Acid Sigma-Aldrich Cat#B6768 Phalloidin-iFluor594 Abcam Cat#176757 Triton X-100 Sigma-Aldrich Cat#T8787-50ML (Continued on next page) e1 Cell Reports Methods 4, 100909, December 16, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Sigma-Aldrich Cat#A2153-10G Agarose Sigma-Aldrich Cat#A9539-100G 4% Paraformaldehyde ThermoFisher Cat#I28800 Xylene, Reagent Grade Sigma-Aldrich Cat#214736 Eosin Y solution, Alcoholic Sigma-Aldrich Cat#HT110116 Mayer’s Hematoxylin Agilent Cat#S330930-2 Expert XTF Mounting Medium CellPath Cat#SEA-1900-00A Alcian blue Sigma-Aldrich Cat#A3157-10G Schiff’s Reagent Sigma-Aldrich Cat#3952016-500ML Sirius Red F3B Sigma-Aldrich Cat#365548-5G Saturated Aqueous Picric Acid Sigma-Aldrich Cat#P6744-1GA Mowiol 4-88 Sigma-Aldrich Cat#81381-50G DABCO 33-LV Sigma-Aldrich Cat#290734-100ML Dulbecco’s Modified Eagle’s Medium, High Glucose Sigma-Aldrich Cat#D6546 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74104 Deposited data Bulk RNA-seq data This paper GSE277147 Microscopy data This paper https://doi.org/10.5281/ zenodo.11639336 Experimental models: Cell lines OESO-005 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0290-C15 OESO-191 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0543-C15 OESO-195 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0546-C15 CAF1412 This paper See Table 1 CAF669 This paper See Table 1 L-Wnt3A ATCC Cat#CRL-2647; RRID:CVCL_0635 HA-R-Spondin1-FC 293T R&D Systems Cat#3710-001-01; RRID:CVCL_RU08 Software and RNA Sequencing:Article Title: Patient-derived tumor organoid and fibroblast assembloid models for interrogation of the tumor microenvironment in esophageal adenocarcinoma Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-Pan-Cytokeratin (Clone AE1/AE3) Agilent Cat#M351529-2; RRID:AB_2132885 Rabbit Anti-Vimentin Cell Signaling Technology Cat#5741S; RRID:AB_10695459 Rabbit Anti-Cytokeratin 7 (Clone EPR1619Y) Abcam Cat#Ab68459; RRID:AB_1139824 Mouse Anti-Cytokeratin 20 (Clone Ks20.8) Invitrogen Cat#MA5-13263; RRID:AB_10981940 Rabbit Anti-Ki-67 Abcam Cat#Ab15580; RRID:AB_443209 Mouse Anti-alpha Smooth Muscle Actin (clone 1A4) Agilent Cat#M085101-2; RRID:AB_2223500 Rabbit Anti-Periostin Abcam Cat#Ab14041;RRID:AB_2299859 Alexa Fluor 488 Goat Anti-Mouse IgG Invitrogen Cat#A-11029; RRID:AB_2534088 Alexa Fluor 633 Goat Anti-Mouse IgG Invitrogen Cat#A-21052; RRID:AB_2535719 Alexa Fluor 488 Goat Anti-Rabbit IgG Invitrogen Cat#A-11008; RRID:AB_143165 Alexa Fluor 568 Goat Anti-Rabbit IgG Invitrogen Cat#A-11036; RRID:AB_10563566 Biological samples Human esophageal adenocarcinoma FFPE blocks University Hospital Southampton, Department of Cellular Pathology See Table 1 Chemicals, peptides, and recombinant proteins DAPI Sigma-Aldrich Cat#D9542-5MG Hanks’ Balanced Salt Solution ThermoFisher Cat#14025092 Amphotericin B ThermoFisher Cat#15290026 Collagenase P Sigma-Aldrich Cat#11213865001 Primocin InvivoGen Cat#ant-pm-05 Penicillin-Streptomycin ThermoFisher Cat#15140122 Cultrex Basement Membrane Extract, Type 2, Pathclear Bio-Techne Cat#3532-005-02 Advanced DMEM/F12 ThermoFisher Cat#12634010 HEPES ThermoFisher Cat#15630056 GlutaMAX ThermoFisher Cat#35050061 N-2 Supplement ThermoFisher Cat#17502048 B-27 Supplement ThermoFisher Cat#17504044 Recombinant Human Noggin Peprotech Cat#120-10C-500 Recombinant Human EGF Peprotech Cat#AF-100-15-1000 Recombinant Human FGF-10 Peprotech Cat#100-26-1000 N-Acetylcysteine Sigma-Aldrich Cat#A9165-5g Nicotinamide Sigma-Aldrich Cat#N0636-100g A83-01 TOCRIS Cat#2939-10mg SB202190 Stem Cell Technologies Cat#72634 Y-27632 Sigma-Aldrich Cat#Y0503-5MG TrypLE Express ThermoFisher Cat#12604013 Fructose Sigma-Aldrich Cat#F3510-100G Glycerol Sigma-Aldrich Cat#G5516-500ML Urea Sigma-Aldrich Cat#51456-500G Zwittergent 3-10 Sigma-Aldrich Cat#693021-5GM Boric Acid Sigma-Aldrich Cat#B6768 Phalloidin-iFluor594 Abcam Cat#176757 Triton X-100 Sigma-Aldrich Cat#T8787-50ML (Continued on next page) e1 Cell Reports Methods 4, 100909, December 16, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Sigma-Aldrich Cat#A2153-10G Agarose Sigma-Aldrich Cat#A9539-100G 4% Paraformaldehyde ThermoFisher Cat#I28800 Xylene, Reagent Grade Sigma-Aldrich Cat#214736 Eosin Y solution, Alcoholic Sigma-Aldrich Cat#HT110116 Mayer’s Hematoxylin Agilent Cat#S330930-2 Expert XTF Mounting Medium CellPath Cat#SEA-1900-00A Alcian blue Sigma-Aldrich Cat#A3157-10G Schiff’s Reagent Sigma-Aldrich Cat#3952016-500ML Sirius Red F3B Sigma-Aldrich Cat#365548-5G Saturated Aqueous Picric Acid Sigma-Aldrich Cat#P6744-1GA Mowiol 4-88 Sigma-Aldrich Cat#81381-50G DABCO 33-LV Sigma-Aldrich Cat#290734-100ML Dulbecco’s Modified Eagle’s Medium, High Glucose Sigma-Aldrich Cat#D6546 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74104 Deposited data Bulk RNA-seq data This paper GSE277147 Microscopy data This paper https://doi.org/10.5281/ zenodo.11639336 Experimental models: Cell lines OESO-005 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0290-C15 OESO-191 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0543-C15 OESO-195 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0546-C15 CAF1412 This paper See Table 1 CAF669 This paper See Table 1 L-Wnt3A ATCC Cat#CRL-2647; RRID:CVCL_0635 HA-R-Spondin1-FC 293T R&D Systems Cat#3710-001-01; RRID:CVCL_RU08 Software and Microscopy:Article Title: Patient-derived tumor organoid and fibroblast assembloid models for interrogation of the tumor microenvironment in esophageal adenocarcinoma Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-Pan-Cytokeratin (Clone AE1/AE3) Agilent Cat#M351529-2; RRID:AB_2132885 Rabbit Anti-Vimentin Cell Signaling Technology Cat#5741S; RRID:AB_10695459 Rabbit Anti-Cytokeratin 7 (Clone EPR1619Y) Abcam Cat#Ab68459; RRID:AB_1139824 Mouse Anti-Cytokeratin 20 (Clone Ks20.8) Invitrogen Cat#MA5-13263; RRID:AB_10981940 Rabbit Anti-Ki-67 Abcam Cat#Ab15580; RRID:AB_443209 Mouse Anti-alpha Smooth Muscle Actin (clone 1A4) Agilent Cat#M085101-2; RRID:AB_2223500 Rabbit Anti-Periostin Abcam Cat#Ab14041;RRID:AB_2299859 Alexa Fluor 488 Goat Anti-Mouse IgG Invitrogen Cat#A-11029; RRID:AB_2534088 Alexa Fluor 633 Goat Anti-Mouse IgG Invitrogen Cat#A-21052; RRID:AB_2535719 Alexa Fluor 488 Goat Anti-Rabbit IgG Invitrogen Cat#A-11008; RRID:AB_143165 Alexa Fluor 568 Goat Anti-Rabbit IgG Invitrogen Cat#A-11036; RRID:AB_10563566 Biological samples Human esophageal adenocarcinoma FFPE blocks University Hospital Southampton, Department of Cellular Pathology See Table 1 Chemicals, peptides, and recombinant proteins DAPI Sigma-Aldrich Cat#D9542-5MG Hanks’ Balanced Salt Solution ThermoFisher Cat#14025092 Amphotericin B ThermoFisher Cat#15290026 Collagenase P Sigma-Aldrich Cat#11213865001 Primocin InvivoGen Cat#ant-pm-05 Penicillin-Streptomycin ThermoFisher Cat#15140122 Cultrex Basement Membrane Extract, Type 2, Pathclear Bio-Techne Cat#3532-005-02 Advanced DMEM/F12 ThermoFisher Cat#12634010 HEPES ThermoFisher Cat#15630056 GlutaMAX ThermoFisher Cat#35050061 N-2 Supplement ThermoFisher Cat#17502048 B-27 Supplement ThermoFisher Cat#17504044 Recombinant Human Noggin Peprotech Cat#120-10C-500 Recombinant Human EGF Peprotech Cat#AF-100-15-1000 Recombinant Human FGF-10 Peprotech Cat#100-26-1000 N-Acetylcysteine Sigma-Aldrich Cat#A9165-5g Nicotinamide Sigma-Aldrich Cat#N0636-100g A83-01 TOCRIS Cat#2939-10mg SB202190 Stem Cell Technologies Cat#72634 Y-27632 Sigma-Aldrich Cat#Y0503-5MG TrypLE Express ThermoFisher Cat#12604013 Fructose Sigma-Aldrich Cat#F3510-100G Glycerol Sigma-Aldrich Cat#G5516-500ML Urea Sigma-Aldrich Cat#51456-500G Zwittergent 3-10 Sigma-Aldrich Cat#693021-5GM Boric Acid Sigma-Aldrich Cat#B6768 Phalloidin-iFluor594 Abcam Cat#176757 Triton X-100 Sigma-Aldrich Cat#T8787-50ML (Continued on next page) e1 Cell Reports Methods 4, 100909, December 16, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bovine Serum Albumin Sigma-Aldrich Cat#A2153-10G Agarose Sigma-Aldrich Cat#A9539-100G 4% Paraformaldehyde ThermoFisher Cat#I28800 Xylene, Reagent Grade Sigma-Aldrich Cat#214736 Eosin Y solution, Alcoholic Sigma-Aldrich Cat#HT110116 Mayer’s Hematoxylin Agilent Cat#S330930-2 Expert XTF Mounting Medium CellPath Cat#SEA-1900-00A Alcian blue Sigma-Aldrich Cat#A3157-10G Schiff’s Reagent Sigma-Aldrich Cat#3952016-500ML Sirius Red F3B Sigma-Aldrich Cat#365548-5G Saturated Aqueous Picric Acid Sigma-Aldrich Cat#P6744-1GA Mowiol 4-88 Sigma-Aldrich Cat#81381-50G DABCO 33-LV Sigma-Aldrich Cat#290734-100ML Dulbecco’s Modified Eagle’s Medium, High Glucose Sigma-Aldrich Cat#D6546 Critical commercial assays RNeasy Mini Kit Qiagen Cat#74104 Deposited data Bulk RNA-seq data This paper GSE277147 Microscopy data This paper https://doi.org/10.5281/ zenodo.11639336 Experimental models: Cell lines OESO-005 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0290-C15 OESO-191 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0543-C15 OESO-195 Gift from Dr. Matthew Garnett, Wellcome Sanger Institute, Cambridge, UK Cell Model Passport ID: HCM-SANG-0546-C15 CAF1412 This paper See Table 1 CAF669 This paper See Table 1 L-Wnt3A ATCC Cat#CRL-2647; RRID:CVCL_0635 HA-R-Spondin1-FC 293T R&D Systems Cat#3710-001-01; RRID:CVCL_RU08 Software and Article Title: In vivo differentiation of embryonic cells devoid of key reprogramming factors. Article Snippet: 55,56 The maintenance of fish lines was carried out in accordance with the AAALAC research guidelines following a protocol approved by the Yale University IACUC. .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCS2+dsRed This paper N/A pCS2+EGFP-CAAX This paper N/A pCS2+nanog Lee et al. 3 N/A pCS2+pou5f3 Lee et al. 3 N/A pCS2-hCD4 This paper N/A Software and Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-Vasa Santa Cruz Biotechnology Cat# sc-26877 (dC-13), RRID:AB_793880 Discontinued Mouse monoclonal anti Fasciclin III Developmental Studies Hybridoma Bank DSHB: 7G10; RRID:AB_528238 Rabbit polyclonal anti STAT92E E. Bach N/A Rabbit polyclonal anti RFP Abcam ab62341; RRID:AB_945213 Mouse monoclonal anti Gamma Tubulin Sigma GTU-88, T6557, RRID:AB_477584 Chick polyclonal anti GFP Aves Labs Cat#GFP-1020; RRID: AB_2307313 Rat monoclonal anti DE-Cadherin Developmental Studies Hybridoma Bank DSHB: DCAD2; RRID: AB_528120 Normal Donkey Serum (NDS) Jackson ImmunoResearch Cat#: 017-000-121; RRID: AB_2337258 Alexafluor Secondary Antibodies (488, 647) Jackson ImmunoResearch RRID: AB_2307351; RRID: AB_2340863; RRID: AB_2340375; RRID: AB_2313584; RRID: AB_2341099; RRID: AB_2340667 Cy3 Affinipure Secondary Antibodies Jackson ImmunoResearch Cat#: 711-165-152; RRID: AB_2307443 Chemicals, peptides, and recombinant proteins Para-Formaldehyde (PFA), 16% Electron Microscopy Sciences Cat#15710 Hoechst Sigma Cat#33342; CAS Number: 875756-97-1 Propyl-gallate Sigma Aldrich SKU: P3130; CAS Number 121-79-9; PubChem Substance ID 24898394 Normal Donkey Serum (NDS) Jackson Immunoresearch Laboratories 017-000-121; RRID: AB_2337258 Ringer’s solution Other doi: https://doi.org/10.1101/pdb.rec12409 Schneider’s Insect Media GIBCO 21720-024 Insulin, bovine Sigma Cat# 10516 Penicillin/ Streptomycin Corning 30-002-Cl Fetal Bovine Serum GIBCO Cat# 10082 Critical commercial assays Gateway LR Clonase II Enzyme mix ThermoFisher Scientific Cat#: 11791020 SpinSmart Plasmid Purification: Low-copy plasmid DNA, P1 constructs, or cosmids Denville Scientific Cat#CM-410-50 Experimental models: Cell lines DH5 alpha Cells NEB Cat#C2987H oneShot Top10 Invitrogen Cat#C404006 Experimental models: Organisms/strains P-Dsix4-eGFP::Moesin Sano et al.59 N/A nos-moesin::GFP Sano et al.60 Flybase: FBtp0040584 UAS-Stat92E RNAi Bloomington Drosophila Stock Center Flybase: FBst0033637; RRID: BDSC_33637 sqh-Sqh::mCherry Rauzi et al.32 N/A sqh-Sqh::GFP3x Pinheiro et al.61 N/A UAS-GFP::Zipper Franke et al.34 N/A UAS-F-Tractin::tdTomato Bloomington Drosophila Stock Center RRID: BDSC_58989 Six4-Gal4 Anllo et al.12 N/A Six4-Gal4::VP16 S. DiNardo This Work nos-Gal4-VP16 Van Doren et al.62 N/A P{CaryP}attP2 Bloomington Drosophia Stock Center Flybase: FBti0040535; RRID: BDSC_8622 (Continued on next page) Current Biology 34, 3917–3930.e1–e6, September 9, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and Concentration Assay:Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Formalin-fixed Paraffin-Embedded:Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Transcriptomics:Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Imaging:Article Title: Microglia aggregates define distinct immune and neurodegenerative niches in Alzheimer's disease hippocampus Article Snippet: DAB kit Roche Cat# 760-159 - - Ready to use* DISCOVERY Purple Kit Roche Cat# 760-229 - - Ready to use* DISCOVERY Teal HRP kit Roche Cat# 760-247 - - Ready to use* DISCOVERY Yellow Kit Roche Cat# 760-239 - - Ready to use* .. Rabbit monoclonal anti-Iba1/AIF1 (E4O4W) Alexa Fluor 594 conjugate** Cell Signalling Technology Cat# 48934, RRID: AB_2923427 - - - Mouse monoclonal anti-GFAP (GA-5) DyLight 594 conjugate** Novus Biologicals Cat# NBP2-33184DL594, RRID: AB_2923514 - - - Mouse monoclonal anti-Aβ (MOAB-2) Alexa Fluor 532 conjugate ** Novus Biologicals Cat# NBP2-13075AF532, RRID: AB_2923428 - - - *Vials ready-to-use purchased from Roche Ventana Medical Systems // ** Concentration of antibodies not provided by NanoString Techonologies Supplementary Table 3 Materials and resources REAGENT OR RESOURCE Biological samples Human post-mortem FFPE hippocampus and prefrontal cortex GIE-Neuro-CEB biobank See Table 1 Human post-mortem PFA-fixed hippocampus Douglas-Bell Brain Bank and GIE-Neuro-CEB biobank See Table 1 Chemicals, peptides, and recombinant proteins Dilution DRAQ7TM Cell Signaling Cat# 7406 1:100 Thiazine Red 0.2μM Sigma Chemicals, St. Louis, MO, USA SYTOTM 13 Green Fluorescent Nucleic Acid Stains Invitrogen Cat# S7575 ProLongTM Gold Antifade Mountant Invitrogen Cat# P36930 Deposited data DSP proteomics and transcriptomics raw data This paper Data available on request DSP proteomics and transcriptomics DEP and DEG, ORA This paper Supplementary files 7 and 8 Raw images This paper Data available on request Software and Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-Vasa Santa Cruz Biotechnology Cat# sc-26877 (dC-13), RRID:AB_793880 Discontinued Mouse monoclonal anti Fasciclin III Developmental Studies Hybridoma Bank DSHB: 7G10; RRID:AB_528238 Rabbit polyclonal anti STAT92E E. Bach N/A Rabbit polyclonal anti RFP Abcam ab62341; RRID:AB_945213 Mouse monoclonal anti Gamma Tubulin Sigma GTU-88, T6557, RRID:AB_477584 Chick polyclonal anti GFP Aves Labs Cat#GFP-1020; RRID: AB_2307313 Rat monoclonal anti DE-Cadherin Developmental Studies Hybridoma Bank DSHB: DCAD2; RRID: AB_528120 Normal Donkey Serum (NDS) Jackson ImmunoResearch Cat#: 017-000-121; RRID: AB_2337258 Alexafluor Secondary Antibodies (488, 647) Jackson ImmunoResearch RRID: AB_2307351; RRID: AB_2340863; RRID: AB_2340375; RRID: AB_2313584; RRID: AB_2341099; RRID: AB_2340667 Cy3 Affinipure Secondary Antibodies Jackson ImmunoResearch Cat#: 711-165-152; RRID: AB_2307443 Chemicals, peptides, and recombinant proteins Para-Formaldehyde (PFA), 16% Electron Microscopy Sciences Cat#15710 Hoechst Sigma Cat#33342; CAS Number: 875756-97-1 Propyl-gallate Sigma Aldrich SKU: P3130; CAS Number 121-79-9; PubChem Substance ID 24898394 Normal Donkey Serum (NDS) Jackson Immunoresearch Laboratories 017-000-121; RRID: AB_2337258 Ringer’s solution Other doi: https://doi.org/10.1101/pdb.rec12409 Schneider’s Insect Media GIBCO 21720-024 Insulin, bovine Sigma Cat# 10516 Penicillin/ Streptomycin Corning 30-002-Cl Fetal Bovine Serum GIBCO Cat# 10082 Critical commercial assays Gateway LR Clonase II Enzyme mix ThermoFisher Scientific Cat#: 11791020 SpinSmart Plasmid Purification: Low-copy plasmid DNA, P1 constructs, or cosmids Denville Scientific Cat#CM-410-50 Experimental models: Cell lines DH5 alpha Cells NEB Cat#C2987H oneShot Top10 Invitrogen Cat#C404006 Experimental models: Organisms/strains P-Dsix4-eGFP::Moesin Sano et al.59 N/A nos-moesin::GFP Sano et al.60 Flybase: FBtp0040584 UAS-Stat92E RNAi Bloomington Drosophila Stock Center Flybase: FBst0033637; RRID: BDSC_33637 sqh-Sqh::mCherry Rauzi et al.32 N/A sqh-Sqh::GFP3x Pinheiro et al.61 N/A UAS-GFP::Zipper Franke et al.34 N/A UAS-F-Tractin::tdTomato Bloomington Drosophila Stock Center RRID: BDSC_58989 Six4-Gal4 Anllo et al.12 N/A Six4-Gal4::VP16 S. DiNardo This Work nos-Gal4-VP16 Van Doren et al.62 N/A P{CaryP}attP2 Bloomington Drosophia Stock Center Flybase: FBti0040535; RRID: BDSC_8622 (Continued on next page) Current Biology 34, 3917–3930.e1–e6, September 9, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and other:Article Title: An optimized method to visualize lipid droplets in mouse brain tissue. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey serum Merck Cat# S30-100mL Ethylene glycol Sigma-Aldrich Cat# 324558-1L Sodium azide solution (NaN3 0.05%) Sigma-Aldrich Cat# RTC000068 Paraformaldehyde, EM Grade, Purified Electron microscopy Cat# 19208; CAS #30525-89-4 DMEM/F-12, GlutaMAXTM supplement Gibco Cat# 31331-028 B-27TM Supplement (50X), serum free Gibco Cat# 17504044 N-2 Supplement (100x) Gibco Cat# 17502048 Human EGF, Animal-Free Recombinant Protein PeproTech Cat# AF-100-15 Human FGF-basic (FGF-2/bFGF) (154 aa) Recombinant Protein PeproTech Cat# 100-18B Heparin sodium salt from porcine intestinal mucosa Sigma-Aldrich Cat# H3149-50KU Poly-L-ornithine hydrobromide Sigma-Aldrich Cat# P3655 Mouse Laminin from Engelbreth-Holm-Swarm murine sarcoma basement membrane Sigma-Aldrich Cat# L2020-1MG FluorSaveTM Reagent Merck Millipore Cat# 345789 Antibiotic-Antimycotic (100X) Gibco Cat# 15240062 Glycine Sigma-Aldrich Cat# G8898 BSA Sigma-Aldrich Cat# A8806-5G Saponin Sigma-Aldrich Cat# 84510-100G Critical commercial assays MACS Neural Tissue Dissociation Kit (Papain-based) Miltenyi Biotec RRID: SCR_020293; Cat# 130-092-628 MACS Myelin Removal Beads II Miltenyi Biotec Cat# 130-096-731 QuadroMACS Separator Miltenyi Biotec Cat# 130-090-976 gentleMACS Dissociator Miltenyi Biotec Cat# 130-093-235 Experimental models: Cell lines Neural progenitor stem cells extracted from C57BL/6Rj WT mouse line Janvier N/A Neural progenitor stem cells extracted from tdTom-Plin2 mouse line Prof. Marlen Knobloch (University of Lausanne, Lausanne) N/A Experimental models: Organisms/strains Mouse: C57BL/6Rj WT Janvier Labs N/A Mouse: tdTom-Plin2 mouse line Prof. Marlen Knobloch (University of Lausanne, Lausanne) N/A Software and Plasmid Preparation:Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-Vasa Santa Cruz Biotechnology Cat# sc-26877 (dC-13), RRID:AB_793880 Discontinued Mouse monoclonal anti Fasciclin III Developmental Studies Hybridoma Bank DSHB: 7G10; RRID:AB_528238 Rabbit polyclonal anti STAT92E E. Bach N/A Rabbit polyclonal anti RFP Abcam ab62341; RRID:AB_945213 Mouse monoclonal anti Gamma Tubulin Sigma GTU-88, T6557, RRID:AB_477584 Chick polyclonal anti GFP Aves Labs Cat#GFP-1020; RRID: AB_2307313 Rat monoclonal anti DE-Cadherin Developmental Studies Hybridoma Bank DSHB: DCAD2; RRID: AB_528120 Normal Donkey Serum (NDS) Jackson ImmunoResearch Cat#: 017-000-121; RRID: AB_2337258 Alexafluor Secondary Antibodies (488, 647) Jackson ImmunoResearch RRID: AB_2307351; RRID: AB_2340863; RRID: AB_2340375; RRID: AB_2313584; RRID: AB_2341099; RRID: AB_2340667 Cy3 Affinipure Secondary Antibodies Jackson ImmunoResearch Cat#: 711-165-152; RRID: AB_2307443 Chemicals, peptides, and recombinant proteins Para-Formaldehyde (PFA), 16% Electron Microscopy Sciences Cat#15710 Hoechst Sigma Cat#33342; CAS Number: 875756-97-1 Propyl-gallate Sigma Aldrich SKU: P3130; CAS Number 121-79-9; PubChem Substance ID 24898394 Normal Donkey Serum (NDS) Jackson Immunoresearch Laboratories 017-000-121; RRID: AB_2337258 Ringer’s solution Other doi: https://doi.org/10.1101/pdb.rec12409 Schneider’s Insect Media GIBCO 21720-024 Insulin, bovine Sigma Cat# 10516 Penicillin/ Streptomycin Corning 30-002-Cl Fetal Bovine Serum GIBCO Cat# 10082 Critical commercial assays Gateway LR Clonase II Enzyme mix ThermoFisher Scientific Cat#: 11791020 SpinSmart Plasmid Purification: Low-copy plasmid DNA, P1 constructs, or cosmids Denville Scientific Cat#CM-410-50 Experimental models: Cell lines DH5 alpha Cells NEB Cat#C2987H oneShot Top10 Invitrogen Cat#C404006 Experimental models: Organisms/strains P-Dsix4-eGFP::Moesin Sano et al.59 N/A nos-moesin::GFP Sano et al.60 Flybase: FBtp0040584 UAS-Stat92E RNAi Bloomington Drosophila Stock Center Flybase: FBst0033637; RRID: BDSC_33637 sqh-Sqh::mCherry Rauzi et al.32 N/A sqh-Sqh::GFP3x Pinheiro et al.61 N/A UAS-GFP::Zipper Franke et al.34 N/A UAS-F-Tractin::tdTomato Bloomington Drosophila Stock Center RRID: BDSC_58989 Six4-Gal4 Anllo et al.12 N/A Six4-Gal4::VP16 S. DiNardo This Work nos-Gal4-VP16 Van Doren et al.62 N/A P{CaryP}attP2 Bloomington Drosophia Stock Center Flybase: FBti0040535; RRID: BDSC_8622 (Continued on next page) Current Biology 34, 3917–3930.e1–e6, September 9, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and |